circad | circRNAs associated with diseases

Hsa_circ_0000520
Gene	RPPH1	Organism	Human
Genome Locus	chr14:20811436-20811559:-	Build	hg19
Disease	Gastric Cancer	ICD-10	Stomach, Malignant neoplasm of unspecified (C16.9)
DBLink	Link to database	PMID	29103021
Experimental Method
Sample Type	MKN-45, BGC-823, MGC- 80 803 and AGS cell lines, Tissue and Blood samples	Comparison	56 pairs of gastric cancer tissues and corresponding sample
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward GTCTGAGACTAGGGCCAGAGGC Reverse GACATGGGAGTGGAGTGACAGG	Statistics	Fold Change : Downregulated pvalue : p<0.05
Citation
Sun, H, Tang, W, Rong, D, Jin, H, Fu, K, Zhang, W, Liu, Z, Cao, H, Cao, X (2018). Hsa_circ_0000520, a potential new circular RNA biomarker, is involved in gastric carcinoma. Cancer Biomark, 21, 2:299-306.